UCSC Genome Browser: BLAT tool

Last updated on 2025-12-22 | Edit this page

Estimated time: 30 minutes

Overview

Questions

  • What is the BLAT tool and how do we use it?

Objectives

  • Use the BLAT tool to locate genomic regions with similarity to a sequence of interest

The BLAT tool

The BLAT tool is a sequence similarity tool similar to BLAST. It can quickly identify region(s) of homology between a genome and a sequence of interest. Due to the presence of orthologs and paralogs, a target sequence may have similarity to more than one region in the genome.

Exercise

In this exercise, we will employ the BLAT tool to map the sequences of two different expression probes to their target regions and determine which NTRK2 gene transcripts the probes are likely to detect.

Callout

A note on microarray expression data

Microarray expression data is not commonly used now, but some of the data generated from large, well-orchestrated studies still provide valuable information to researchers. Microarray probes, like in situ hybridisation probes, target a small region of the RNA and do not measure the whole RNA transcript. If you are measuring gene expression, it is important to know exactly which region of the gene you are detecting.

The study was the Human Brain Gene Expression Atlas generated by the Allen Institute. Below are sequences of two hybridisation probes that were use in a microarray used to detect expression of the NTRK2 gene. These two probes result in very different hybridisation and expression patterns across different regions of the brain. As we observed in the previous exercise, NTRK2 has a number of different transcript variants.


Our question: are these probes detecting different NTRK2 transcripts, and if yes, which ones?


The probes

The images below are of one of the six donors included in the atlas, and typical of the expression pattern for NTRK2. These images are taken from the NTRK2 gene page of Human Brain Atlas.

Most obvious in the images is the high level of expression signal using Probe A_23_P216779 and low level for A_24_P343559 in the corpus callosum (CC), which is a region of white matter in the brain with relatively few neurons and relatively high proportion of myelinating oligodendrocytes. This expression profile is reversed in the the cortical regions, eg. frontal lobe (FL) and parietal lobe (PL), which have a relatively high density of neuronal cells.

NTRK2 Probe A_23_P216779

Sequence: TTCTATACTCTAATCAGCACTGAATTCAGAGGGTTTGACTTTTTCATCTATAACACAGTG

Z score of expression level in Human brain (blue = low expression, red = high expression)
Z score of expression level in Human brain (blue = low expression, red = high expression)

NTRK2 Probe A_24_P343559

Sequence: AAGCTGCTCTCCTTCACTCTGACAGTATTAACATCAAAGACTCCGAGAAGCTCTCGAGGG

Z score of expression level in Human brain (blue = low expression, red = high expression)
Z score of expression level in Human brain (blue = low expression, red = high expression)


Your task

1. Use the BLAT tool to find region of homology

  1. Select Toolbar > tools > blat

  2. Copy the sequence of the first probe above and paste into the search box

  3. Under Assembly, select the human GRCh38 and click Submit

Probe A_23_P216779 returns 2 hits for different chromosomes. One of these has 100% homology over the whole 60 base sequence, the other has 87% homology over a 24 base region.
Probe A_23_P216779 returns 2 hits for different chromosomes. One of these has 100% homology over the whole 60 base sequence, the other has 87% homology over a 24 base region.

  1. Select Rename Custom Track. Copy and paste the probe name to use as the label for the Custom track name and Custom track description. Click Submit. It is not necessary to build a custom track, but this enables you to give your sequence a unique name which is important if you are doing multiple BLAT searches and want be able to tell which one is which.

  2. Select browser for the hit with the highest homology to view the result. Observe which region of the NTRK2 gene this probe will target. Zoom out for context.

  3. Note that a new blue bar heading has appeared for your custom tracks.

  4. Repeat for the other probe sequence.


2. Use the highlight tool to keep track of region of interest in the genome view.

It is easy to lose track of a region you are investigating when navigating around the genome in a browser. We are going to highlight each region of probe homology within the NTRK2 gene, using a different colour for each probe. Highlight is also useful if you have lots of different tracks loaded and you want to check that a feature on one track lines up with another.

  1. Use drag-and-select to select only the region of homology for each probe within the NTRK2 gene. Use a different highlight for each region.

  2. Zoom out to view the whole gene again.

Discussion

DISCUSS

Do the probes detect coding regions of the NTRK2 gene?

Discussion

Discuss

Are the probes likely to detect different transcripts?


3. Use ‘Multiregion view’ to make it easier to compare coding regions of different transcripts

  1. Toolbar > View > Multi-Region

  2. Select Show exons using GENCODE V48

This view makes it easier to check what region of each transcript is likely to be detected by the probes
This view makes it easier to check what region of each transcript is likely to be detected by the probes


Key Points
  • We can use the UCSC BLAT tool to identify region(s) of similarity between a sequence of interest and other parts of the genome.